Does the QIAseq miRNA Library Kit require a custom sequencing primer on AVITI?

The QIASeq miRNA Library Kit has two product versions, the Version 1 of the kit containing a single index (#331505) and the Version 2 containing unique dual indices (e.g. #331502, #331601, #331905). Both are natively compatible with Adept circularization and Cloudbreak, though the Version 1 kit requires you to spike in an additional small RNA sequencing primer - “5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC”. Add 32ul of 100uM stock of HPLC purified primer into the Cloudbreak Read 1 primer tube before sequencing.

Both QIASeq product versions are compatible with Cloudbreak Freestyle with no primer spike-in required.