Does the QIAseq miRNA Library Kit require a custom sequencing primer on AVITI? | Element Biosciences

Question

Does the QIAseq miRNA Library Kit require a custom sequencing primer on AVITI or AVITI24™?

Answer

The QIAseq miRNA Library Kit does not require a custom sequencing primer when sequenced with Cloudbreak Freestyle™ on AVITI. If you are using the Version 1 kit with Adept™ circularization and Cloudbreak™ sequencing, see Considerations for additional guidance.

Summary

Both of the QIAseq miRNA Library Kit product versions (1 and 2) are compatible with Cloudbreak Freestyle and Cloudbreak sequencing on AVITI.

• No primer spike-in is required for Cloudbreak Freestyle sequencing with either product version
• No primer spike-in is required for Cloudbreak sequencing with Version 2
• A custom sequencing primer spike-in is required for Cloudbreak sequencing with Version 1

Considerations

The QIAseq miRNA Library Kit has two product versions, the Version 1 of the kit containing a single index (e.g. #331505) and the Version 2 containing unique dual indexes (e.g. #331502, #331601, #331905).

Cloudbreak Freestyle Sequencing

Both QIAseq product versions are compatible with Cloudbreak Freestyle with no primer spike-in required.

Cloudbreak Sequencing

Both QIAseq product versions are natively compatible with Adept circularization and Cloudbreak, but the Version 1 kit requires you to spike-in an additional small RNA sequencing primer: “5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC”. Add 32 µl of 100 µM stock of HPLC-purified primer into the Cloudbreak Read 1 primer tube before sequencing. The Version 2 kit does not require a custom primer spike-in.