Where can I find the Elevate sequences? | Element Biosciences

PCR-free adapters (also known as Y-shaped or “forked” adapters) with partial single stranded ends are necessary for many applications. However, these forked adapters alter the migration properties of the libraries through capillary or gel electrophoresis matrices, which can complicate the accurate sizing of these libraries before loading. To improve accuracy a short, “fork-collapse” PCR step can be performed prior to sizing.

Materials:

• KAPA HiFi Hotstart ReadyMix, 1.25mL (Catalog#: 07958927001) or Watchmaker Equinox Amplifcation Master Mix (Catalog #: 7K0021-024)
• For Adept / Third Party libraries use the provided amplification primer mix in the above kits
• For Elevate-style libraries, the below primers (HPLC purified)
  • SP5 5ʹ Phosphate-CATGTAATGCACGTACTTTCAGGGT
  • SP27 5ʹ GATCAGGTGAGGCTGCGACGACT

Protocol:

In a low-bind PCR strip tube combine 0.01-0.05pmol of PCR-free linear library with the below mix:

And amplify libraries with the following cycling conditions:

*Extension time should be extended to 60seconds for large libraries (>800 bp) Proceed to post-PCR cleanup.

Post-PCR Cleanup:

1. Add 1X SPRI beads to the PCR reaction
2. Pipette mix or vortex and spin down.
3. Incubate 5 minutes.
4. Place on magnet and allow beads to pellet.
5. Remove and discard supernatant without disturbing the pellet.
6. Add 200ul fresh 80% EtOH and incubate on magnet ≥30 seconds.
7. Remove and discard the EtOH.
8. Add 200ul fresh 80% EtOH and incubate on magnet ≥30 seconds.
9. Remove and discard the EtOH.
10. Allow the bead pellet to dry 3-5 minutes. Do not over dry.
11. Add 32ul of Low TE or Tris-HCl, pH 7.0 to 8.0 to the dry bead pellet.
12. Pipette mix or vortex and spin down.
13. Incubate 2 minutes.
14. Place on magnet and allow beads to pellet.
15. Transfer 30ul of final library to a 1.5mL LoBind Tube.
16. Use Qubit for quantification and Fragment Analyzer, Bioanalyzer or Tapestation to size the final library following manufacturer recommendations